Lymantria monacha

Illumina HiSeq 4000 paired end sequencing

Illumina sequencing of sample accession SAMEA7519946 for study accession PRJEB42098. This is part of an Illumina multiplexed sequencing run (37935_7). This submission includes reads tagged with the sequence TTCGGGAT.

{'gal': 'University of Oxford', 'sex': 'male', 'tolid': 'ilLymMona1', 'habitat': 'Woodland', 'lifestage': 'adult', 'broker name': 'COPO', 'common name': 'black-arched tussock moth', 'external id': 'SAMEA7519946', 'sample name': '5fa2a2db7b78180001144b2c', 'specimen id': 'Ox000063', 'collected by': 'DOUGLAS BOYES', 'insdc status': 'public', 'project name': 'DTOL', 'submitter id': '5fa2a2db7b78180001144b2c', 'gal_sample_id': 'Ox000063', 'identified by': 'DOUGLAS BOYES', 'organism part': 'THORAX | ABDOMEN', 'collection date': '2019-07-17', 'ena-last-update': '2021-07-02T15:18:05Z', 'scientific_name': 'Lymantria monacha', 'ena-first-public': '2020-11-04T13:59:53Z', 'insdc center name': 'EarlhamInstitute', 'insdc last update': '2021-07-02T15:18:05Z', 'insdc first public': '2020-11-04T13:59:53Z', 'sample derived from': 'SAMEA7519912', 'collecting institution': 'University of Oxford', 'identifier_affiliation': 'University of Oxford', 'geographic location (latitude)': '51.764', 'geographic location (elevation)': '150', 'geographic location (longitude)': '-1.327', 'geographic location (country and/or sea)': 'United Kingdom', 'geographic location (region and locality)': 'Wytham | near Ant Hills'}

RNA-seq of Lymantria monacha: ovaries

Ovaries dissected, RNA extracted using Trizol, mRNA purified using poly-T oligo-attached magnetic beads, fragmentation, first strand cDNA synthesis using random hexamer primers, second strand cDNA synthesis, end repair, A-tailing, adapter ligation, size selection, amplification, purification. Adapter sequences (Novogene) are AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT and GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATGACTATCTCGTATGCCGTCTTCTGCTTG

{'sex': 'female', 'tissue': 'Ovary', 'isolate': 'Ovary', 'dev_stage': 'Adult', 'collected_by': 'Peter Holland', 'geo_loc_name': 'United Kingdom: Wytham', 'biosamplemodel': 'Invertebrate', 'collection_date': '2021-09-02', 'isolation_source': 'Wild UK caught'}

RNA-seq of Lymantria monacha: larvae

Eggs from ELG (Entomological Livestock Group, UK); captive bred. Larvae hatched 9 March 2022, RNA extracted 10 March 2022. RNA from 12 larvae extracted using QIAGEN RNAeasy Plus Micro kit, mRNA purified using poly-T oligo-attached magnetic beads, fragmentation, first strand cDNA synthesis using random hexamer primers, second strand cDNA synthesis, end repair, A-tailing, adapter ligation, size selection, amplification, purification. Adapter sequences are AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT and GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATGACTATCTCGTATGCCGTCTTCTGCTTG

{'tissue': 'Whole', 'isolate': 'Larvae', 'dev_stage': '1st instar larvae', 'collected_by': 'Peter Mulhair', 'geo_loc_name': 'United Kingdom', 'biosamplemodel': 'Invertebrate', 'collection_date': '2022-03-10', 'isolation_source': 'Laboratory reared UK stock'}