Nymphulinae

RNA sequencing of Paracymoriza distinctalisadult female exoskeleton

PacBiosequeIIsequencingdatausedinassemblyanalysis

{'host': 'Acentropinae', 'breed': 'Paracymoriza distinctalis', 'tissue': 'Exoskeleton', 'isolate': 'adult female', 'geo_loc_name': 'China:Shaanxi', 'biosamplemodel': 'Invertebrate', 'collection_date': '2020', 'isolation_source': 'shore'}

Illumina NovaSeq 6000 paired end sequencing

Illumina sequencing of sample accession SAMEA10979372 for study accession PRJEB52476. This is part of an Illumina multiplexed sequencing run (45657_1). This submission includes reads tagged with the sequence GCCTAGGG.

{'gal': 'University of Oxford', 'sex': 'NOT COLLECTED', 'tolid': 'ilAceEphe3', 'habitat': 'Woodland', 'lifestage': 'adult', 'broker name': 'Collaborative Open Plant Omics broker account, Earlham Institute, Norwich', 'external id': 'SAMEA10979372', 'sample name': '618e9d3673e26544ea537b0b', 'specimen id': 'Ox001729', 'collected by': 'Douglas Boyes', 'insdc status': 'public', 'project name': 'DTOL', 'submitter id': '618e9d3673e26544ea537b0b', 'gal_sample_id': 'Ox001729', 'identified by': 'Douglas Boyes', 'organism part': 'WHOLE ORGANISM', 'sample same as': 'SAMEA10978993', 'collection date': '2021-07-17', 'ena last update': '2021-11-15', 'barcoding center': 'NOT PROVIDED', 'ena first public': '2021-11-15', 'insdc center name': 'EarlhamInstitute', 'insdc last update': '2021-11-15T13:11:25Z', 'insdc center alias': 'EarlhamInstitute', 'insdc first public': '2021-11-15T13:11:25Z', 'collecting institution': 'University of Oxford', 'identifier_affiliation': 'University of Oxford', 'geographic location (latitude)': '51.772', 'geographic location (elevation)': '150', 'geographic location (longitude)': '-1.338', 'geographic location (country and/or sea)': 'United Kingdom', 'geographic location (region and locality)': 'Berkshire | Wytham woods'}

RNA-seq of Nymphula nitidulata: ovaries

Ovaries dissected into RNAProtect, Qiagen RNAeasy micro kit extraction, mRNA purified using poly-T oligo-attached magnetic beads, fragmentation, first strand cDNA synthesis using random hexamer primers, second strand cDNA synthesis, end repair, A-tailing, adapter ligation, size selection, amplification, purification. Adapter sequences are AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT and GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATGACTATCTCGTATGCCGTCTTCTGCTTG

{'sex': 'female', 'tissue': 'Ovary', 'isolate': 'Ovary', 'dev_stage': 'Adult', 'collected_by': 'Peter Holland', 'geo_loc_name': 'United Kingdom: Wytham', 'biosamplemodel': 'Invertebrate', 'collection_date': '2021-06-30', 'isolation_source': 'Wild UK caught'}