Orgyia antiqua

RNA-seq of Orgyia antiqua: male antennae

The antennae used for RNAseq was from a wild caught male from Wytham Woods, Oxfordshire (collected 08 Sept 2020). The antenna was separated manually, and RNA extracted using the MirVana kit from Invitrogen at the Sanger Institute. The NEB Ultra II Directional RNA Library Prep Kit was used, following manufacturers recommendations with the following adaptations - use of TSQ adapter, Sanger UDI tag set and Kapa Hifi Polymerase. 16 PCR cycles were used, and the resulting library was sequenced on the HiSeq 4000.

{'sex': 'male', 'tissue': 'Antennae', 'isolate': 'Adult male', 'dev_stage': 'Adult', 'collected_by': 'Douglas Boyes', 'geo_loc_name': 'United Kingdom: Wytham', 'biosamplemodel': 'Invertebrate', 'collection_date': '2020-09-08', 'isolation_source': 'Wild UK caught'}

RNA-seq of Orgyia antiqua: larvae

Female parent captive reared from eggs from Worldwide Butterflies, Dorset, UK; male parent was wild caught moth Wallingford, Oxfordshire, UK; eggs laid 8/2021, overwintered, larvae hatched F2/2022; 30 x first instar larvae collected 21 Feb 2022. Method: Larvae homogenized in RNAProtect, RNA extracted using QIAGEN RNAeasy Plus Micro kit, mRNA purified using poly-T oligo-attached magnetic beads, fragmentation, first strand cDNA synthesis using random hexamer primers, second strand cDNA synthesis, end repair, A-tailing, adapter ligation, size selection, amplification, purification. Adapter sequences are AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT and GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATGACTATCTCGTATGCCGTCTTCTGCTTG

{'tissue': 'Whole', 'isolate': 'Larvae', 'dev_stage': '1st instar larvae', 'collected_by': 'Peter Holland', 'geo_loc_name': 'United Kingdom', 'biosamplemodel': 'Invertebrate', 'collection_date': '2022-02-21', 'isolation_source': 'Laboratory reared UK stock'}

RNA-seq of Orgyia antiqua: eggs/embryos

~200 eggs collected 36h after egg-laying; Female parent captive reared from eggs from Worldwide Butterflies, Dorset, UK; male parent was wild moth Wallingford, Oxfordshire, UK; For Location use UK. Mating 28 Aug 2021, eggs laid 28 Aug 2021; RNA extracted 29 Aug 2021. Method: RNA extracted using Trizol, mRNA purified using poly-T oligo-attached magnetic beads, fragmentation, first strand cDNA synthesis using random hexamer primers, second strand cDNA synthesis, end repair, A-tailing, adapter ligation, size selection, amplification, purification. Adapter sequences are AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT and GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATGACTATCTCGTATGCCGTCTTCTGCTTG

{'tissue': 'Whole', 'isolate': 'Eggs/embryos', 'dev_stage': '36h ael embryonic', 'collected_by': 'Peter Holland', 'geo_loc_name': 'United Kingdom', 'biosamplemodel': 'Invertebrate', 'collection_date': '2021-08-29', 'isolation_source': 'Laboratory reared UK stock'}